ID: 1142743495_1142743507

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1142743495 1142743507
Species Human (GRCh38) Human (GRCh38)
Location 17:1943449-1943471 17:1943470-1943492
Sequence CCCGCAGCCCCCTGGGCAGGGCC CCGTGGGGCTCTCTGGGTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 96, 4: 755} {0: 1, 1: 0, 2: 3, 3: 25, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!