ID: 1142752756_1142752769

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1142752756 1142752769
Species Human (GRCh38) Human (GRCh38)
Location 17:1998389-1998411 17:1998428-1998450
Sequence CCGCGCGGGGAGCCGCGGCCGCG CTCGCGGGAGCCGCCGGCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 293} {0: 1, 1: 0, 2: 2, 3: 13, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!