ID: 1142803068_1142803073

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1142803068 1142803073
Species Human (GRCh38) Human (GRCh38)
Location 17:2357042-2357064 17:2357087-2357109
Sequence CCATCAGCATCTGTGGTCTCCAG TGCAGAACTTGATGGCTTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 364} {0: 1, 1: 0, 2: 0, 3: 19, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!