ID: 1142841115_1142841123

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1142841115 1142841123
Species Human (GRCh38) Human (GRCh38)
Location 17:2631393-2631415 17:2631427-2631449
Sequence CCCACCCCATTCAGATGGTTACA GAGAATTCCTTCTCCCTGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 114} {0: 1, 1: 0, 2: 3, 3: 46, 4: 1460}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!