ID: 1142849738_1142849745

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1142849738 1142849745
Species Human (GRCh38) Human (GRCh38)
Location 17:2698590-2698612 17:2698630-2698652
Sequence CCTGGCGGGGGTCGAGGAGGGCA CACAAGAGCCTGCATCCACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 238} {0: 1, 1: 0, 2: 0, 3: 14, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!