ID: 1142881554_1142881562

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1142881554 1142881562
Species Human (GRCh38) Human (GRCh38)
Location 17:2885866-2885888 17:2885918-2885940
Sequence CCAGCATTATTGACATTGATGCA CTGGAAATGATTCGGCAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 120} {0: 1, 1: 0, 2: 0, 3: 11, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!