ID: 1142884780_1142884785

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1142884780 1142884785
Species Human (GRCh38) Human (GRCh38)
Location 17:2905755-2905777 17:2905769-2905791
Sequence CCTCTGGCTGGCCCTTCTGAGCT TTCTGAGCTGGGCCTGTTCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 21, 4: 260} {0: 1, 1: 0, 2: 0, 3: 24, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!