ID: 1142888903_1142888913

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1142888903 1142888913
Species Human (GRCh38) Human (GRCh38)
Location 17:2930251-2930273 17:2930272-2930294
Sequence CCAATACCATCAGTACCACGTGG GGGAGCCTGTGGCTGGGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 99} {0: 1, 1: 0, 2: 11, 3: 121, 4: 1118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!