ID: 1142891681_1142891692

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1142891681 1142891692
Species Human (GRCh38) Human (GRCh38)
Location 17:2948024-2948046 17:2948039-2948061
Sequence CCTTGTCCCCTCCGTGTGTCCTG GTGTCCTGGATTGGGGTGGGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 36, 4: 283} {0: 1, 1: 0, 2: 2, 3: 66, 4: 606}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!