ID: 1142956864_1142956866

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1142956864 1142956866
Species Human (GRCh38) Human (GRCh38)
Location 17:3528547-3528569 17:3528565-3528587
Sequence CCCAGCTAGTTCTATATTTACAG TACAGACAGAGACCCTGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 61, 4: 1245} {0: 1, 1: 0, 2: 2, 3: 16, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!