ID: 1142966228_1142966238

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1142966228 1142966238
Species Human (GRCh38) Human (GRCh38)
Location 17:3583519-3583541 17:3583567-3583589
Sequence CCAGGAGGCACAGCCTCCATCAG TTATTAGGGGAGCGCCCGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 42, 4: 308} {0: 1, 1: 0, 2: 0, 3: 1, 4: 53}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!