ID: 1142980057_1142980068

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1142980057 1142980068
Species Human (GRCh38) Human (GRCh38)
Location 17:3666495-3666517 17:3666543-3666565
Sequence CCCAGGAGGAGGAGGAGCAGGTT GCAGGTGTCCAGAAGGCAGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 14, 3: 153, 4: 800} {0: 1, 1: 0, 2: 3, 3: 47, 4: 437}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!