ID: 1142995208_1142995218

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1142995208 1142995218
Species Human (GRCh38) Human (GRCh38)
Location 17:3755968-3755990 17:3756010-3756032
Sequence CCAGCTTGGCCTCACTCCCAGAA CAGGAAGAGAACCCGGCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 305} {0: 1, 1: 0, 2: 0, 3: 16, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!