ID: 1142996194_1142996206

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1142996194 1142996206
Species Human (GRCh38) Human (GRCh38)
Location 17:3761914-3761936 17:3761951-3761973
Sequence CCAAAACACCGTGGTGGCTCCGG CCGGTGCCTCCCCTTGGGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 43} {0: 1, 1: 0, 2: 4, 3: 29, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!