ID: 1143017083_1143017095

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1143017083 1143017095
Species Human (GRCh38) Human (GRCh38)
Location 17:3896634-3896656 17:3896674-3896696
Sequence CCAGACCTTCTGTTCAGACAGAG GCTGGGGCTGAGCCACAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 147} {0: 1, 1: 0, 2: 4, 3: 87, 4: 659}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!