ID: 1143029773_1143029781

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1143029773 1143029781
Species Human (GRCh38) Human (GRCh38)
Location 17:3961471-3961493 17:3961496-3961518
Sequence CCGAGGCTCCCCAGCTCTGAAGT CTGTGTGCAGTGAGGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 347} {0: 1, 1: 4, 2: 5, 3: 66, 4: 688}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!