ID: 1143053620_1143053625

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1143053620 1143053625
Species Human (GRCh38) Human (GRCh38)
Location 17:4146183-4146205 17:4146207-4146229
Sequence CCTCCCGGGTTCAATATTCTTGT CCCCAGCCTCCCGAGGAGCTAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 6, 3: 33, 4: 189} {0: 17, 1: 1877, 2: 110558, 3: 304716, 4: 331069}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!