ID: 1143091682_1143091690

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1143091682 1143091690
Species Human (GRCh38) Human (GRCh38)
Location 17:4452728-4452750 17:4452761-4452783
Sequence CCTGGGGTGCAGGGTGATCACCC TGGGATCCCCAGGATGAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 139} {0: 1, 1: 0, 2: 4, 3: 41, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!