ID: 1143136733_1143136753

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1143136733 1143136753
Species Human (GRCh38) Human (GRCh38)
Location 17:4716488-4716510 17:4716536-4716558
Sequence CCTGTTCATCGCCACCTACCAGG CCGGCCCCCCACCCGCCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 91} {0: 1, 1: 0, 2: 3, 3: 65, 4: 693}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!