ID: 1143164329_1143164338

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1143164329 1143164338
Species Human (GRCh38) Human (GRCh38)
Location 17:4890299-4890321 17:4890351-4890373
Sequence CCTGCTGCTGGTAACGGGTCCCT GCTTCTTTGCTGGAACGGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 76} {0: 1, 1: 0, 2: 1, 3: 11, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!