ID: 1143187643_1143187652

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1143187643 1143187652
Species Human (GRCh38) Human (GRCh38)
Location 17:5020261-5020283 17:5020303-5020325
Sequence CCCAGGGAACAGGAAGAGGATGC TTGGTTGACAAGAATGGGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 336} {0: 1, 1: 0, 2: 1, 3: 20, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!