ID: 1143202621_1143202638

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1143202621 1143202638
Species Human (GRCh38) Human (GRCh38)
Location 17:5122901-5122923 17:5122946-5122968
Sequence CCGAGAGCACCCCGAAGCCGGGG AGGGGGCGAAGTCGGCGAGTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 120} {0: 1, 1: 0, 2: 3, 3: 17, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!