ID: 1143209674_1143209677

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1143209674 1143209677
Species Human (GRCh38) Human (GRCh38)
Location 17:5175850-5175872 17:5175877-5175899
Sequence CCTCAGCTTCTATTTGTTCACCT AGTTAAAATACGGAACACTCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!