|
Left Crispr |
Right Crispr |
Crispr ID |
1143301956 |
1143301965 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:5917083-5917105
|
17:5917136-5917158
|
Sequence |
CCTCCTGTATTCAAATAATTCTC |
CAGGCGCATGCCACCACGTCCGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 7, 2: 307, 3: 7235, 4: 62421} |
{0: 44, 1: 999, 2: 10812, 3: 48185, 4: 110041} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|