ID: 1143301956_1143301965

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1143301956 1143301965
Species Human (GRCh38) Human (GRCh38)
Location 17:5917083-5917105 17:5917136-5917158
Sequence CCTCCTGTATTCAAATAATTCTC CAGGCGCATGCCACCACGTCCGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 307, 3: 7235, 4: 62421} {0: 44, 1: 999, 2: 10812, 3: 48185, 4: 110041}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!