ID: 1143322595_1143322600

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1143322595 1143322600
Species Human (GRCh38) Human (GRCh38)
Location 17:6077818-6077840 17:6077847-6077869
Sequence CCCTCTTCCCTTCAGTTATACAG TGTGCTCCCTAGTTTGTAACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 229} {0: 1, 1: 0, 2: 1, 3: 23, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!