ID: 1143381789_1143381791

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1143381789 1143381791
Species Human (GRCh38) Human (GRCh38)
Location 17:6501264-6501286 17:6501289-6501311
Sequence CCCTATATTCATCATGCTTGTTA TTATAATGTTTTGACATCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 240} {0: 1, 1: 2, 2: 9, 3: 71, 4: 349}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!