ID: 1143449643_1143449650

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1143449643 1143449650
Species Human (GRCh38) Human (GRCh38)
Location 17:7028226-7028248 17:7028254-7028276
Sequence CCCCTGTAATTCTAGGTCTGGAA ATTTGTTCTAGGGCAGCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 140} {0: 1, 1: 0, 2: 2, 3: 15, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!