ID: 1143479168_1143479178

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1143479168 1143479178
Species Human (GRCh38) Human (GRCh38)
Location 17:7218794-7218816 17:7218822-7218844
Sequence CCCAGACCTCCCCTCCACAAGGA GTTTTTCACCTCTTGGTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 263} {0: 1, 1: 0, 2: 0, 3: 25, 4: 311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!