ID: 1143563097_1143563101

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1143563097 1143563101
Species Human (GRCh38) Human (GRCh38)
Location 17:7706568-7706590 17:7706595-7706617
Sequence CCCGCTCATAAAAGAGTTCTGTG GAAAAATTCCTACTTCCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 191} {0: 1, 1: 0, 2: 3, 3: 31, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!