|
Left Crispr |
Right Crispr |
| Crispr ID |
1143580034 |
1143580037 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:7820067-7820089
|
17:7820094-7820116
|
| Sequence |
CCACAGTGTTGGGATTACAGGCA |
CCACCACGCCTGGCAAAAACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 71, 1: 8481, 2: 114917, 3: 248829, 4: 238801} |
{0: 1, 1: 4, 2: 32, 3: 254, 4: 1140} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|