ID: 1143660510_1143660514

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1143660510 1143660514
Species Human (GRCh38) Human (GRCh38)
Location 17:8321876-8321898 17:8321896-8321918
Sequence CCTGGCAGAGGAGCCCAAGGGAC GACTGAAGATGGCCAGTAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 287} {0: 1, 1: 0, 2: 0, 3: 12, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!