ID: 1143683191_1143683201

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1143683191 1143683201
Species Human (GRCh38) Human (GRCh38)
Location 17:8492802-8492824 17:8492850-8492872
Sequence CCAAGTTGGAGGCGACCTGGCGC CGTCCAGCTCCTGCTGCAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 38} {0: 1, 1: 1, 2: 4, 3: 46, 4: 313}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!