ID: 1143724360_1143724371

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1143724360 1143724371
Species Human (GRCh38) Human (GRCh38)
Location 17:8835308-8835330 17:8835326-8835348
Sequence CCTCCCCCAGAGCCGCCTGCAGG GCAGGGCGTGGGAGACCACGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 47, 4: 506} {0: 1, 1: 0, 2: 1, 3: 24, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!