ID: 1143756791_1143756803

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1143756791 1143756803
Species Human (GRCh38) Human (GRCh38)
Location 17:9073227-9073249 17:9073259-9073281
Sequence CCTGTCTCCTGAGCGCCGAGACT AAGGTGGGAATCAAAGCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 73} {0: 1, 1: 0, 2: 2, 3: 9, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!