ID: 1143769063_1143769077

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1143769063 1143769077
Species Human (GRCh38) Human (GRCh38)
Location 17:9156395-9156417 17:9156434-9156456
Sequence CCCATCACCAAATGGCCTTCCTG CTGGGCCATGTGAAGTCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 149} {0: 1, 1: 0, 2: 1, 3: 27, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!