ID: 1143783769_1143783779

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1143783769 1143783779
Species Human (GRCh38) Human (GRCh38)
Location 17:9242438-9242460 17:9242467-9242489
Sequence CCCTGCCCAGAAGGGCTGTGGCA CGATATCCCACCCTGGGTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 258} {0: 1, 1: 0, 2: 0, 3: 7, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!