ID: 1143811730_1143811735

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1143811730 1143811735
Species Human (GRCh38) Human (GRCh38)
Location 17:9477146-9477168 17:9477165-9477187
Sequence CCGTGCCCAGCTTCAGGTTCCTC CCTCTGCTTAAAAGGATACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 86, 4: 869} {0: 1, 1: 0, 2: 3, 3: 26, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!