ID: 1143823690_1143823691

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1143823690 1143823691
Species Human (GRCh38) Human (GRCh38)
Location 17:9586644-9586666 17:9586658-9586680
Sequence CCTCAGATGCTTTTAATGCCTCC AATGCCTCCCTATGATCTGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 263} {0: 1, 1: 0, 2: 0, 3: 15, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!