ID: 1143858615_1143858618

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1143858615 1143858618
Species Human (GRCh38) Human (GRCh38)
Location 17:9871570-9871592 17:9871602-9871624
Sequence CCTTCCTCTTTCTGAGATGACAG TTCATAGTCAGTCAGATCATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 335} {0: 1, 1: 0, 2: 0, 3: 7, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!