ID: 1143868554_1143868564

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1143868554 1143868564
Species Human (GRCh38) Human (GRCh38)
Location 17:9941529-9941551 17:9941567-9941589
Sequence CCTCAGCTCTCACCTCTCCTGGC CTATGAGATCCCAAGGTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 87, 4: 657} {0: 1, 1: 0, 2: 3, 3: 198, 4: 3841}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!