ID: 1143873501_1143873512

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1143873501 1143873512
Species Human (GRCh38) Human (GRCh38)
Location 17:9974833-9974855 17:9974871-9974893
Sequence CCACCCAGGGCTCACCCCCACCC TATCTCAGTACCGATCCCTGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 9, 3: 114, 4: 881} {0: 1, 1: 0, 2: 0, 3: 7, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!