ID: 1143900336_1143900348

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1143900336 1143900348
Species Human (GRCh38) Human (GRCh38)
Location 17:10169699-10169721 17:10169737-10169759
Sequence CCATCCCCAGACCTCTTCTCCAT GGTGATCTCATCCAGTACAGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 81, 4: 790} {0: 1, 1: 0, 2: 1, 3: 28, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!