ID: 1143900878_1143900885

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1143900878 1143900885
Species Human (GRCh38) Human (GRCh38)
Location 17:10173889-10173911 17:10173911-10173933
Sequence CCTGGAAAGGGAACAGAGCCATG GAGCACAGGGAGACGGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 312} {0: 1, 1: 0, 2: 1, 3: 31, 4: 513}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!