ID: 1144028345_1144028351

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1144028345 1144028351
Species Human (GRCh38) Human (GRCh38)
Location 17:11298252-11298274 17:11298294-11298316
Sequence CCTCTAGCCTGGAACCAGAAATA AGTGGGACACACAATAAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 167} {0: 1, 1: 0, 2: 0, 3: 13, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!