ID: 1144058103_1144058108

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1144058103 1144058108
Species Human (GRCh38) Human (GRCh38)
Location 17:11559215-11559237 17:11559246-11559268
Sequence CCTGACCATGACTGCCACTCAGG TCCACCCCTGCTCTGCTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 147} {0: 1, 1: 2, 2: 5, 3: 62, 4: 560}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!