ID: 1144085399_1144085407

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1144085399 1144085407
Species Human (GRCh38) Human (GRCh38)
Location 17:11803848-11803870 17:11803876-11803898
Sequence CCACTAATCCTTTCCTGCCCCAA CTGAATCAGGAGAGAGAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 278} {0: 1, 1: 0, 2: 2, 3: 56, 4: 637}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!