ID: 1144090180_1144090186

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1144090180 1144090186
Species Human (GRCh38) Human (GRCh38)
Location 17:11849371-11849393 17:11849422-11849444
Sequence CCTGCCGAAAACACACCAGTGGC ACTCCTCATACTTCTTCCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 128} {0: 1, 1: 0, 2: 1, 3: 29, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!