ID: 1144096151_1144096155

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1144096151 1144096155
Species Human (GRCh38) Human (GRCh38)
Location 17:11902489-11902511 17:11902506-11902528
Sequence CCCAAACATTTTATGCGCTAAAT CTAAATCTTGCATGTTATTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 162} {0: 1, 1: 0, 2: 1, 3: 5, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!