ID: 1144096152_1144096155

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1144096152 1144096155
Species Human (GRCh38) Human (GRCh38)
Location 17:11902490-11902512 17:11902506-11902528
Sequence CCAAACATTTTATGCGCTAAATC CTAAATCTTGCATGTTATTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 121} {0: 1, 1: 0, 2: 1, 3: 5, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!