ID: 1144107228_1144107245

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1144107228 1144107245
Species Human (GRCh38) Human (GRCh38)
Location 17:11997245-11997267 17:11997291-11997313
Sequence CCCAGCCATGGCTGCCCCGGCCC GCTCCCAGACGCATGGGCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 383} {0: 1, 1: 0, 2: 0, 3: 7, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!